Primer

Erweiterte Suche

Der Titel dieses Artikels ist mehrdeutig. Weitere Bedeutungen sind unter Primer (Begriffsklärung) aufgeführt.

Als Primer (Pl.: die Primer; IPA: [ˊpʁaɪ̯mɐ]) wird in der Molekularbiologie ein Oligonukleotid bezeichnet, das als Startpunkt für DNA-replizierende Enzyme wie die DNA-Polymerase dient.

DNA-Polymerasen benötigen eine Hydroxygruppe als Startpunkt für ihre erste Verknüpfungsreaktion. Primer stellen mit ihrem 3'-OH-Ende eine passende Hydroxyfunktion zur Verfügung. Primer können sowohl aus DNA als auch aus RNA bestehen. Bei der Replikation dient in Prokaryoten und Eukaryoten RNA als Primermaterial. In Prokaryoten synthetisiert die Primase, auch als DnaG-Protein bezeichnet, die Primersequenzen. In Eukaryoten besitzt die DNA-Polymerase α eine Primasefunktion. Einen Sonderfall stellt die DNA-Synthese an den Telomeren eukaryotischer Zellen dar. Hier dient dem polymerisierendem Enzym Telomerase das 3'-OH-Ende der DNA als Primersequenz. Bei Prokaryoten werden die bei der Replikation auftauchenden Primer durch 5'-3'-Exonukleaseaktivität der Polymerase I oder durch die RNase H entfernt. In eukaryotischen Zellen werden die Primer durch verdrängende DNA-Synthese der Polymerase δ und Restriktion durch die Flap-Endonuklease entfernt.

Auch bei der In-vitro-Amplifikation von DNA, beispielsweise bei der Polymerase-Kettenreaktion (PCR), der DNA-Sequenzierung oder bei der reversen Transkription, werden Primer benötigt. Hier lässt sich mit Hilfe der Primer der spezifische DNA-Abschnitt, der amplifiziert werden soll, festlegen.

Für die PCR werden deshalb Nukleotidsequenzen, die den zu amplifizierenden DNA-Abschnitt flankieren, bestimmt. Gemäß diesen Sequenzen werden nun passende Primersequenzen synthetisch hergestellt. Ein Primer repräsentiert hierbei jeweils den gegenläufigen Strang zu seinem „Primerpartner“. Primer für PCR-Ansätze haben in der Regel eine Länge von 18-30 Nukleotiden. Diverse Biotechnologiefirmen bieten mittlerweile maßgeschneiderte Primer für molekularbiologische Anwendungen an. Durch maßgeschneiderte Missmatchprimer lassen sich über die PCR-Technik auch gezielt Mutationen in Gene einführen, die z.B. im Austausch einer Aminosäure bestehen.

Primerdesign

Primer werden mit dem Ziel designt, an spezifischer Stelle mit dem DNA-Template zu binden und so gezielte PCR-Produkte oder Hybridisierungen zu ermöglichen. Nebst den Reaktionsbedingungen (Temperatur, Puffer, Konzentrationen von Template und Primer) spielt auch der Aufbau des Primers selbst eine entscheidende Rolle. Die Schmelztemperatur (TM) eines Primers hängt von seiner Länge und seiner Zusammensetzung (GC-Gehalt) ab. Die Länge des Primers (typisch 18 bis 30 Nukleotide) wird so gewählt, dass seine Schmelztemperatur passend zur Annealing-Temperatur des PCR- oder Hybridisierungs-Prozesses ist (siehe Ablauf einer PCR-Reaktion). Der GC-Gehalt spielt eine besondere Rolle, da die Doppelhelix durch eine hohe Anzahl aufeinander folgender GC-Paarungen auf Grund von Stapelwechselwirkungen stabiler ist. Die Schmelztemperatur nimmt also mit der Anzahl an G- und C-Nukleotiden zu. Die Schmelztemperatur (in Grad Celsius) lässt sich mit mehreren Methoden berechnen:

  • die Wallace-Regel:
    $ T_{\mathrm {M} }=2\cdot (A+T)+4\cdot (G+C) $
  • die GC-Methode ist die einfachste aber auch ungenaueste Methode:
    $ T_{M}=64+41{\frac {G+C-16{,}4}{A+G+C+T}} $
  • die „salt adjusted“-Methode ist etwas genauer und bezieht die Konzentration an Na+-Ionen im Reaktionsansatz mit ein:
    $ T_{\mathrm {M} }=100,5+41\cdot {\frac {C+G}{A+C+G+T}}-{\frac {820}{A+C+G+T}}\cdot 16{,}6\cdot \log _{10}([{\mbox{Na}}^{+}]) $
  • die komplizierteste Methode ist die „base stacking“-Methode, bei der die Enthalpie- und Entropieterme der Helixbildung bei der Hybridisierung mit einbezogen werden:
    $ T_{\mathrm {M} }={\frac {\Delta H{\frac {\mbox{cal}}{\mbox{mol}}}}{\Delta S+R\ln({\frac {\text{primer}}{2}})}}-273{,}15\ ^{\circ }{\mbox{C}} $

Mittlerweile gibt es aber eine große Anzahl an Software, mit der man die Schmelztemperatur von Primern berechnen kann.

Degenerierte Primer

Degenerierte Primer werden verwendet, um mehrere homologe Gene (in verschiedenen Spezies) oder paraloge Gene (innerhalb einer Spezies) mit einem Primerpaar zu amplifizieren. Sie spielen auch eine entscheidende Rolle bei der de novo Sequenzierung von bislang unbekannten Gensequenzen, wenn also auch die Primer-Target-Sequenzen unbekannt sind.

Bei degenerierten Primern handelt es sich prinzipiell um ein Gemisch aus ähnlichen Primer-Sequenzen die in einem degeneriertem Code zusammengefasst werden. Degenerierte Primer können also auch dann noch auf eine Target-Sequenz passen, wenn diese sich im Laufe der Evolution verändert hat.

So steht beispielsweise die Sequenz

  • NTAACGTATGCGATATCGGS

für ein Gemisch der Sequenzen

  • ATAACGTATGCGATATCGGC
  • TTAACGTATGCGATATCGGC
  • GTAACGTATGCGATATCGGC
  • CTAACGTATGCGATATCGGC
  • ATAACGTATGCGATATCGGG
  • TTAACGTATGCGATATCGGG
  • GTAACGTATGCGATATCGGG
  • CTAACGTATGCGATATCGGG

Bei degenerierten Primern stellt das Primerdesign eine besondere Herausforderung dar. Primereigenschaften und mögliche Primer-Primer Interaktionen sowie mögliches Target-Mispriming müssen für jede der möglichen Sequenzen separat untersucht werden. Eine Vielzahl verschiedener Software Tools wurde speziell zum Design degenerierter Primer basierend auf Alignments oder Konsensus-Sequenzen entwickelt (z.B. easyPAC)

Weblinks

Die cosmos-indirekt.de:News der letzten Tage

22.11.2022
Exoplaneten | Teleskope
Weltraumteleskop JWST: Neues von den Atmospären von Exoplaneten
Beobachtungen des Exoplaneten WASP-39b mit dem James-Webb-Weltraumteleskop (JWST) haben eine Fülle von Informationen über die Atmosphäre des Planeten geliefert.
21.11.2022
Galaxien | Schwarze Löcher | Teleskope
Schärfster Blick in den Kern eines Quasars
Eine internationale Gruppe von Wissenschaftlern präsentiert neue Beobachtungen des ersten jemals identifizierten Quasars.
22.11.2022
Festkörperphysik | Physikdidaktik
Chemielehrbücher: Es gibt keine Kohlensäure - Falsch!
Die Existenz von Kohlensäure war in der Wissenschaft lange umstritten: theoretisch existent, praktisch kaum nachweisbar, denn an der Erdoberfläche zerfällt die Verbindung.
21.11.2022
Quantenphysik
Ein Quant als Winkel
Die Feinstrukturkonstante ist eine der wichtigsten Naturkonstanten überhaupt: In Wien fand man nun eine bemerkenswerte neue Art, sie zu messen – nämlich als Drehwinkel.
21.11.2022
Akustik | Quantenoptik
Akustische Quantentechnologie: Lichtquanten mit Höchstgeschwindigkeit sortiert
Einem deutsch-spanischen Forscherteam ist es gelungen einzelne Lichtquanten mit höchster Präzision zu kontrollieren.
18.11.2022
Schwarze Löcher | Relativitätstheorie
Rekonstruktion eines ungewöhnlichen Gravitationswellensignals
Ein Forschungsteam aus Jena und Turin (Italien) hat die Entstehung eines ungewöhnlichen Gravitationswellensignals rekonstruiert.
18.11.2022
Thermodynamik | Festkörperphysik
Bläschenbildung: Siedeprozess deutlich genauer als bisher beschrieben
Siedet eine Flüssigkeit in einem Gefäß, bilden sich am Boden winzige Dampfbläschen, die aufsteigen und Wärme mit sich nehmen.
15.11.2022
Sterne | Planeten | Atomphysik | Quantenphysik
Neues vom Wasserstoff: Erkenntnisse über Planeten und Sterne
Mit einer auf Zufallszahlen basierenden Simulationsmethode konnten Wissenschaftler die Eigenschaften von warmem dichten Wasserstoff so genau wie nie zuvor beschreiben.